MSAD_210019.t1 (mRNA; Medicago sativa )

Unique NameMSAD_210019.t1
OrganismMedicago sativa (alfalfa)
Sequence length225

This mRNA is a part of the following gene feature(s):

Feature NameUnique NameSpeciesType
MSAD_210019MSAD_210019Medicago sativagene

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
MSAD_210019.t1MSAD_210019.t1-proteinMedicago sativapolypeptide

The following exon feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
MSAD_210019.t1:exon:19MSAD_210019.t1:exon:19Medicago sativaexon
MSAD_210019.t1:exon:20MSAD_210019.t1:exon:20Medicago sativaexon

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
MSAD_210019.t1:cdsMSAD_210019.t1:cdsMedicago sativaCDS

The feature 'MSAD_210019.t1' has the following synonyms
The following sequences are available for this feature:

mRNA sequence

>MSAD_210019.t1 ID=MSAD_210019.t1|Name=MSAD_210019.t1|organism=Medicago sativa|type=mRNA|length=225bp
back to top

protein sequence of MSAD_210019.t1

>MSAD_210019.t1-protein ID=MSAD_210019.t1-protein|Name=MSAD_210019.t1|organism=Medicago sativa|type=polypeptide|length=75bp
back to top

mRNA from alignment at Scc4a34_9:6084..6417+

Legend: exonCDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>MSAD_210019.t1 ID=MSAD_210019.t1|Name=MSAD_210019.t1|organism=Medicago sativa|type=mRNA|length=334bp|location=Sequence derived from alignment at Scc4a34_9:6084..6417+ (Medicago sativa)
atggaagtcgtagatatgctcgttagatttcctaggaactattacatgct tcgattcgataaggctaggccactttatgccctttttagtgaaagaaaaa gggtcaaaaacgagtaaaatccgtaaattaacaaggaaattcacttaacc cccattttggccgtttttgaaaattctaaaatcaaccatggaagtcgtag atatgctcgttagatttcctaggaactattacatgcttcgattcgataag gctaggccactttatgccctttttagtgaaagaaaaaggtcaaaaacgag taaaatccgtaaattaacaaggaaattcacttaa
back to top

Coding sequence (CDS) from alignment at Scc4a34_9:6084..6417+

>MSAD_210019.t1 ID=MSAD_210019.t1|Name=MSAD_210019.t1|organism=Medicago sativa|type=CDS|length=225bp|location=Sequence derived from alignment at Scc4a34_9:6084..6417+ (Medicago sativa)
back to top
Property NameValue
NoteUncharacterized protein MAKER:0.0:0.48:Medtr2g084470
CADL Non-redundant FlagN
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of Medicago sativa2016-01-05
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Scc4a34_9supercontigScc4a34_9:6084..6417 +