MSAD_210005.t1 (mRNA; Medicago sativa )

Unique NameMSAD_210005.t1
OrganismMedicago sativa (alfalfa)
Sequence length1158

This mRNA is a part of the following gene feature(s):

Feature NameUnique NameSpeciesType
MSAD_210005MSAD_210005Medicago sativagene

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
MSAD_210005.t1MSAD_210005.t1-proteinMedicago sativapolypeptide

The following exon feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
MSAD_210005.t1:exon:0MSAD_210005.t1:exon:0Medicago sativaexon
MSAD_210005.t1:exon:1MSAD_210005.t1:exon:1Medicago sativaexon
MSAD_210005.t1:exon:2MSAD_210005.t1:exon:2Medicago sativaexon
MSAD_210005.t1:exon:3MSAD_210005.t1:exon:3Medicago sativaexon

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
MSAD_210005.t1:cdsMSAD_210005.t1:cdsMedicago sativaCDS

The feature 'MSAD_210005.t1' has the following synonyms
The following sequences are available for this feature:

mRNA sequence

>MSAD_210005.t1 ID=MSAD_210005.t1|Name=MSAD_210005.t1|organism=Medicago sativa|type=mRNA|length=1158bp
back to top

protein sequence of MSAD_210005.t1

>MSAD_210005.t1-protein ID=MSAD_210005.t1-protein|Name=MSAD_210005.t1|organism=Medicago sativa|type=polypeptide|length=208bp
back to top

mRNA from alignment at Scc4a34_6:10743..13377+

Legend: exonCDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>MSAD_210005.t1 ID=MSAD_210005.t1|Name=MSAD_210005.t1|organism=Medicago sativa|type=mRNA|length=2635bp|location=Sequence derived from alignment at Scc4a34_6:10743..13377+ (Medicago sativa)
gcagtaataattttggcttgtttaacccttgcagtggttgactcgacgac aagcacacttagtgcgtgcccaacagggtatccctctgtctgaatacggg gtaagatttgccttcattgcaatataattagctgtttagttacatatctt gtgaaaactgttttttttatagcagtatttctaataatgtccttaaaaca tggatttttcccccataattgtccccctataaagaaaagggcagggagta ggacagtattttaagttctatcttgaatccgtaactggtgcagtactgca gtcaatcattattcatttgttaacattggcataaacttgtaatctgacga catggtatgaagcttgcttttcagctggtgccatgcatctgataccggat aatacacttttagatatgggtataattctttttaacatattagtctgttt tgattttgtttaccatacatgtttccattttatgaagttaaaaactagca atccctgcaaactgcatgttggattgcttggaatgtgatagattattatg tttaaacaaatttttcgtgattatataatgattatatttacttttcaccg tcagtagctggtttttatctgttctgcataataacaaggttctagggcac atatgttatgggcacagtcccatgtatgtcatgtgggttgtaagtcttcc gccttcctcaagacatttatttttcatcagaggaaatctgtttcgaagct catactgttggattctttctggaggcatcacaatcagtattgctttatct tatttcagagattgtacatatggggttgattgaatcattgaagcataatt tgtgatcatattcttagcattctcaatgtatattcatttctgtttgatta tccacactacaacaattagatggtaacagttgctatttttcgttttgtta gattttggtcgatatgattcgcgtgcctgattgggcatttgaagctgcag gtcaagaaacaaggggcatgggccaagatactgcttcatatcatccagga ctttacctaacaccggctcaggtagttttagttgatgtttgcggacttgt tgatttcatattagaactcatgcaaagcagcagaatgtttttctttgaaa agtagagtgaactgtattgtcatgtagattaattagctgcgaaatatttt gccttaattatgtagagggagaggaagacctaagaaaaccattagagaaa accattagaaaagatttagaggtcaatgaattggatccaaatatgatctt tgatagaacactatggcgtcatttgatccatgtagccgaccccacttagt gggataaggcttgttgttgttgttgttgttgttgtatgctattattcata tggttgtgttttcagacaatatgtttgctgttgttatgccatatatttat ctcaatcaaattccttttgtatatttatattcaatttcagtgctgataat aaggtttcatgtctgggttggatgcagagagaagcagtcgaagctttaat tcaggaactcccaaagttcaggttgaaggctgttcctactgattgcagtg aatgccccatctgcttagaagagttccgtgttgggaatgaggtatacttt tctaaatccaattaaaggtctagagcaagtcatactaattaccatgtgct gtttgccatctgatactgaaaataattctccatttaacctcgagaactct ttacgttaaagatgtaatgtgtatcttcaagtgatttaaaaatagtccca ctgtaatgcaggttcgtggcttgccttgtgcacacaattttcatgttgaa tgcattgacgagtggcttaggctgaatgtgaagtgtcctaggtgccgttg ctcagtgtttccaaatcttgatcttagtgccctgtccaatctccgtcctg attctgaacgatcttctgccagtgttgtgacaacaactagatacgttaga ggccaaccttctagtcaaagttacttgttaaggttacaggggcttctccg ccctgtgcgtgctgaaattgcagggccagttgatgacacagataatgctt tgcaaaatgctgagaacggtgttgcacctgttttgacacaaaatgcacca aacagagtccagggctcaacggtggaatgcatgcctgtcagtctttcttc tgcacaaagttagattatgtagttttaagctttgactagaataggttaaa gaatgcacatccacatctgggctgtaaaaaaatggttcacattctaacat gaaatttttacattgatccatgaagaaatgggtcagtttctttgtccggg gcttcttcaagtggcgcagtaggacttggaaaatcaaggtataccttttt gctttactaacctagatcagaactgcagatctgtaattgtctttttttct tttttccttctagccttttatgtttgatcaagtgtaaaaagagtttgaaa ttctaatcagatggagtatgtgttcctttacctgttccattttgttgggc gtagtattactaatactattttattgggagagggtgatataggcgtagtt tttttatttttctttctaaatgagtttgtaggtga
back to top

Coding sequence (CDS) from alignment at Scc4a34_6:10743..13377+

>MSAD_210005.t1 ID=MSAD_210005.t1|Name=MSAD_210005.t1|organism=Medicago sativa|type=CDS|length=624bp|location=Sequence derived from alignment at Scc4a34_6:10743..13377+ (Medicago sativa)
back to top
Property NameValue
NoteRING-finger ubiquitin ligase MAKER:10.3:0.06:Medtr4g106960
CADL Non-redundant FlagY
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Gene Ontology Update2017-11-12
Whole Genome Assembly and Annotation of Medicago sativa2016-01-05
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Scc4a34_6supercontigScc4a34_6:10743..13377 +
Gene Ontology
GO Assignments
This mRNA is annotated with the following GO terms.
Category Term Accession Term Name
cellular_component GO:0016021 integral component of membrane
molecular_function GO:0016874 ligase activity
molecular_function GO:0008270 zinc ion binding