MSAD_210004.t1 (mRNA; Medicago sativa )

Unique NameMSAD_210004.t1
OrganismMedicago sativa (alfalfa)
Sequence length624

This mRNA is a part of the following gene feature(s):

Feature NameUnique NameSpeciesType
MSAD_210004MSAD_210004Medicago sativagene

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
MSAD_210004.t1MSAD_210004.t1-proteinMedicago sativapolypeptide

The following exon feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
MSAD_210004.t1:exon:4MSAD_210004.t1:exon:4Medicago sativaexon
MSAD_210004.t1:exon:5MSAD_210004.t1:exon:5Medicago sativaexon
MSAD_210004.t1:exon:6MSAD_210004.t1:exon:6Medicago sativaexon

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
MSAD_210004.t1:cdsMSAD_210004.t1:cdsMedicago sativaCDS

The feature 'MSAD_210004.t1' has the following synonyms
The following sequences are available for this feature:

mRNA sequence

>MSAD_210004.t1 ID=MSAD_210004.t1|Name=MSAD_210004.t1|organism=Medicago sativa|type=mRNA|length=624bp
back to top

protein sequence of MSAD_210004.t1

>MSAD_210004.t1-protein ID=MSAD_210004.t1-protein|Name=MSAD_210004.t1|organism=Medicago sativa|type=polypeptide|length=164bp
back to top

mRNA from alignment at Scc4a34_6:3767..5332+

Legend: exonCDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>MSAD_210004.t1 ID=MSAD_210004.t1|Name=MSAD_210004.t1|organism=Medicago sativa|type=mRNA|length=1566bp|location=Sequence derived from alignment at Scc4a34_6:3767..5332+ (Medicago sativa)
atgcctccaccacgcttaaaaccagtactatttgtgagtcggaaatcaga gtttagagtatgggatgataaacaccacccgtggaaaacctctgtggata atggtttatctgatagagggaagaaacagagtatcagagctgcttttgat ttgaaagaaatgggtgcttgtgataataattgttggatttggcctgctat tactcagagagcttatcaaactctgaattattgcttctgttaattctatt actagaaggttgttatgttggtttttttagttgttcttgttaatattgat gatgtgttttctggttttaattttgggattgtgaattgtttgatttcagt tatattgttccggaatacagctttcttgatgccggggattaggtgcttat gaaggaaaaactttagaatatgtttcagaagtaagattctcactccatgt actgttttatttactttagctatgttatatgatgacttctagttgaaaaa tgtctcatgcagactgtagtaggttgattcttgaaaattatccgaaactc taataataattgttgtcggtcctcctaacaagaatctcatgtattactcg tcctggttactaagaaggtgatttaattggtgttggtttgacaaaaaaag aattttaatgtcttgagttgaaactcaactcaagttcatatctgttttct ttgtttttgtcgaatcaacattgatcagatcaccatcttattcataagaa actacggacacgagaaccttgaacttctacttaaaaatgggaatgttgat cattgtcaaaattttaagcgattttcaagatcagtgcactatagatcgca tgcatgtaacactttcacactctagcttatatatgtatttcattacaaat acgattacaatttcactatgttgtggagctaagcataaattttgcaatga gattaaaaatgtgtaatggtggtgcagatatatgcatcagatggtatatc tacaaaataaaacctcctcccattgatgacggaactccaaatgagagtgt tgcagatgtttttgttcgtgtgacccaactcatgtcaatccttgaaactc aatacgctggtgacacagtcgttatagtctcgccagattcggataacttg tcaatccttcaggctggtttggtaggcctagacttgcgaaggtaactaac caactaactagatactccaacctcaaccaaccaaagcctctgcaattata tatatgagtttaattttaattctgtatcacattcattttgtttcttattt acaagtgtctcaaattcaggcacagggagttgtcttttgcacctggtgaa gttcgccaggttgataccaatgacattcctacttacaagatgcctccatc tgctgtatataaatgctccagctaccaattgtaattagctcttttattcc ttcaccttatataccaataaatggacatgtatagctcaagtttgtacatc tgtgtttttaatatttattgtaatactttcctgacagaaaataaaattgt tattatgttgattaaa
back to top

Coding sequence (CDS) from alignment at Scc4a34_6:3767..5332+

>MSAD_210004.t1 ID=MSAD_210004.t1|Name=MSAD_210004.t1|organism=Medicago sativa|type=CDS|length=492bp|location=Sequence derived from alignment at Scc4a34_6:3767..5332+ (Medicago sativa)
back to top
Property NameValue
NotePhosphoglycerate mutase MAKER:12.5:0.18:Medtr4g106970
CADL Non-redundant FlagN
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of Medicago sativa2016-01-05
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Scc4a34_6supercontigScc4a34_6:3767..5332 +