MSAD_210101 (gene; Medicago sativa )

Overview
NameMSAD_210101
Unique NameMSAD_210101
Typegene
OrganismMedicago sativa (alfalfa)
Relationships

The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
MSAD_210101.t1MSAD_210101.t1Medicago sativamRNA


Synonyms
The feature 'MSAD_210101' has the following synonyms
Synonym
maker-Scc4a34_26-augustus-gene-3.37
Sequences
The following sequences are available for this feature:

gene from alignment at Scc4a34_26:352582..354857+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>MSAD_210101 ID=MSAD_210101|Name=MSAD_210101|organism=Medicago sativa|type=gene|length=2276bp|location=Sequence derived from alignment at Scc4a34_26:352582..354857+ (Medicago sativa)
AAATATTTGACCTCTAACCAGCTCAAATCAATGACCAAAGAGAAAAGAAT GAATTCCCACTGTGAATCAAGCAGCAAACGTAGAAAAAAGAATTTCCTTG AGGATGTTTCCCTCGTAAGAAAATCAAGCAGCAACCAAGCAAATGTTTCC CTCAGTATCGCTAAACATCTGTTCGCGAAACAACCTAACAACAACATAGT GTTTTCTCCACTGTCGCTTCAAGTTGTTCTCAGCATCATGGTTGCAGGCT CTGAGGGTCCCACACAACAACAGCTTCTCGACTTCCTCCAATTTGAATCC ATTGATCATCTCAACTCCTTTGCTTCTCGGCTCGTTTCCATCATCCTCAA AGATGCTGCTCCTGCAGGTGGACCTCGCCTCTCTTTCGTCAATGGTGTAT GGGTAGATAAAACCCTTTCTATTCAACCTTCCTTCAAACAAATCGTGTCT TCTAATTATAAGGCCACTCTGGCTTCCGTTGATTTCGTAACCAAGGTATG TTTCTGTATCTTCCTCTTTTCACTGCAATACATGCCTTGCTTTTATGCCA TATTTATTAATTTTAAGCTTAGTTAGTGTTATGCATTATTAGTTGTAAAT TAAATTCAATGGCTAGATGTATATCATTAGTATTAGTATTGCTATTGCAG TAGATATGTGTTATGGTATGTTTTGTGAAACTAATTAGTAATAATGGTAA TTACAACATTAGTTGGTTCTGTGAGTTCCTTAGTCTCGCTCATAAGCTTC CTTATTAAATCTTTCCATTTCATGAATAACTTTCAAATTTTGTTATGGTA TGCCTTGTTTGTTATTTTTTCCTTAATCTCGCTCATAATTAAGCTTCCTA ATTTAATCTTTCCATTTAATGAATAACATTAAAAAGACATGAATGGAGAT CCTTAAATTTTTCATAAAAGGGCATCCCATTGCACTAAAGTTGCCGCACA CAAAGGGGATGGGAAGGAGTCACACCATTTTGGTGTATAGTACGTAACCT TACTCTCTTTTTTACACAAGAGATTGTTTTCAAAACTTGAATCTGTGACC TTTCAGTCACGTGACAACAAATTTACCGTTGCGCCAATGCTCCCCGTTTA TCCGTAAACTTCTCATATTCTAGAATTTTGAAACTTAAATGTTCATTTGA GTAGGATTTTGAAGTAACACCTTAGGGCTTATTTATAGAAGGGAATGGTG ATTATTACCAACATTATTGTCTCCTTTAGAATACAACTATTCGACTAAAA TGAACTTAGTGCAACAAGTATCAACTTCTACGAAATCAATTGATGAATGC AACTTTTCTCTCCTTACAATTTTCTAACATCCAATTAATTTAGGATCATA ATATATGAAAATATACCAATAAAAACTTCATTTCTTCTATTGAAATATTA GTGAAAAGAATTCAACTAATCTATTTGCATAACTAATTTTTAGACTTATA AGTTATAACTGATTTGTATAACTGGTTTTTAAAGGCTACTGAAGTGACTA AAGAAGTGAATTTATGGGCTGAAAAGGAGACAAATGGTCTTATTAAAGAA ATTCTTCCTCAATGGTCGGTCGACAACTTAACCAGGCTCATCTTTGCAAA TGCACTGTACTTTAAAGGAACATGGAATCAGAAGTTTGACGCTTCGACAA CAAAACCCTATGATTTTCACCTTCTAAATGGTAACTCGGTCAAGGTTCCC TTCATGACCAGCAAGGAGAAGCAACGTATTAGTGCTTTTAATGATTTTAA AGTTCTCTGTCTTCCTTATGAGCAAGGAAAAGATAAACGTCAAATCTCTA TGTACATTTTTCTTCCAAATGAAAAATGTGGTTTGCCAGCTTTGGTTAAG AACGTAGCTTCTAAATCCGAGTTACTACAAGACAAGCTTCCTTCCCAACA AGTCGAAGTAGGTGAATTTAGAATTCCAAGATTCGAAGTTTCATTTGGAC TTGAAACTTCTGATATGTTGAAGGAGCTAGGAGTAAGATTACCTTTCTCA CATGGAGGTCTGACAAAAATGGTGGACTCTCCTGCACATCAAGACCTTGT TGTTTCAAAAATATTTCAAAAGTCTTTCATTGAAGTAAATGAGGAAGGCA CTGAAGCTGCTGTAGTCAGTGCTGTAACTAAAAGACGTATGGGTTTGAGT ATGCGCACTCCAACTAGACTAGATTTTGTAGCCGACCATCCTTTCCTATT TCTAATTAGAGAAGATTTGACTGGAACAATCCTTTTTATGGGACAAGTGC TCAATCCTCTTGCTGAAAGATCCTAA
back to top
Properties
Property NameValue
NoteSerpin-ZX-like protein MAKER:5.9:0.07:Medtr8g027395
CADL Non-redundant FlagY
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of Medicago sativa2016-01-05
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Scc4a34_26supercontigScc4a34_26:352582..354857 +