MSAD_210098 (gene; Medicago sativa )

Overview
NameMSAD_210098
Unique NameMSAD_210098
Typegene
OrganismMedicago sativa (alfalfa)
Relationships

The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
MSAD_210098.t1MSAD_210098.t1Medicago sativamRNA


Synonyms
The feature 'MSAD_210098' has the following synonyms
Synonym
maker-Scc4a34_26-augustus-gene-3.35
Sequences
The following sequences are available for this feature:

gene from alignment at Scc4a34_26:335065..341060+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>MSAD_210098 ID=MSAD_210098|Name=MSAD_210098|organism=Medicago sativa|type=gene|length=5996bp|location=Sequence derived from alignment at Scc4a34_26:335065..341060+ (Medicago sativa)
ATGTCTTCAGAAGCTGGGTCTAGTAACAAACCTTGGTTAGCTTGTTAACC AAGGGAGTTAGTTTGTTAGAGGAGTTTGTTACAACGTCTAGTTGTATATA TACTCACTCATATGTTGTAAATAGAAGAGAATGTGTGTGAATCAATAAAA ATTTCTATTAGTTTTCTCTCTTTCAGTTTTACAAACAATTATGTTATTTC TCATCTTGCTTAAAACAACTTATTCTTCATAAGCACTTTTGCTGCGCAAA GAACATAGTGATTGTTCTAACAAGTTCAAGGCCTCTTCTGCATTAGCATG ATTTACCAAAATTTAAAGAATAAAATTAACTAATGTTAATTGATATGATT GATTTATTTTTGTTTTAATTTTTTCATTTCATGTGAGTGTATCTATATTA GAATTTCTCTATCCACTAGATCCATTATTGTCATTTTGTTTGTTGCGTCC ATATTATGTAGGTAATCCATCAAGCTAATGCAATGAATACATTATCAATT ATTTAACTGCTTTTATATGAATTATTTAATCATATATACTATATATATGA CATTTTTTTATTAGCAATCTCATAACTACATGAACCAAAATCTAAGTAGG TCATAATTAGAGAGACCTTTGACATAATTAAGTGTAATAAAATTTTGAAA AAGAAAATATATAAAGGGTATCTCAGTAATTTGGAACAGGTGATTTTTAC AACTCCGGTGAGCAAGGTTGAGTTTGATATCAGAGAAAAACGGAATATGA TCCTTGCGGTGCTTTTTGCCAACGCCGAGGGCAATATCCTCATCGAACGG TGAGTACACTCCGATCTCTCTCTGATCTATATATTCTAATTCAAAATTAA TTTCCTCATTTTATCATCTTTTTATTCATTTCATTTTTAATTTTCAGCGT TTTCTTTGATCTGGATTCTGTTTGAAATTTTGATTATATTGGTTTAGCTT GATTTTTAATAGGATTACACTAACACGCTTGTTATTTCCCTAAATCTTAA GTTGTTTTCATAACTTGATTCAGCTTATTTTCATAAGCTCTTCAAGATAG TTTGTCAAAACAGCTTATACCAAAACAATTCCACTTCATTTTATCTTTTG TTATTAAAACAGCTTATACATAAGCGCTTATCATGGTTAAGCTGCAAAAT AAGTTGTTTATCCGAGGAGATGTTATGTTTAGTAAGCTTCATACCTAAGA CTAATATGATAATAGCCTGGGAAATTAGAAAACCAGATTATACATGATAC ATTTTCTACTTTACATGATTTAAGTGAAATCTCACTCTCGACCCGCAATG GTAGCCCCTATCAGATAAAGCCTAGGTAAAGCGCACTAGACTTGGAGATT CGTGCATCCTCTCGGAGAGGGACAAACTCTCTCGCTTGTTAGTCAAGCTT TGAAGGTGCCGCGGCAATGTAAGCTGCAAGCTTAGGCTTTCTCCGGTCAG CTGATATAGACTCCCCATTTGCACTTCTTTGTAAGTTGTTGCTTTGCTTC CAAGAATAAGAATAGAGTTCCACTTAAGCTAAGTTGCGAAGTCGAACTGA ATCCGAATCTAAGTTCTCTCAGATAGGTGTTTAGTGATCTCGAGAATAAG TATAGTGATCTCGAGAAGAAGTTTTGCTTCTTCTTGTCAAATGTAAGAAA CATTCAAACACAAACCAAGGTATTTTATTAAAGCTTCTGATTTCTCTTTA ATCAGATTGAGGGGTTCAGCCCGTTCATTTCTAGTGTTTCATGTTTCAAT TTCCAGTGATACAATAAATATCAGAGAATACACTATGGAATTTTTTTTTT TGTTTTGAAAACTCGGCAACATTATGGAAAATTTTAAAAAATGCATTTTA AAAATAGTTTGAATAATTTTGTAAATTTTCAAAATAATGTTTCCAGTGTT TCTGAAAATGCATTCTCCCTAGGTAGTTTCTATCTTTTCTCTATCGCAAT TAAAAGGGAAAATCAAAATCCATATCACATGTAGGGGTGTAAGCGGTTCG GACTAAACCAATGAAACCGATAGTCTAAACCGGACCAAACCGAAAAAATA TCCGACCTTGTTTGGTTCGGTTTGAAACCGATCCGAACCAATTGAAACCA GTCTAGTTTGGTTTGGTTCATGGTTTTTCATTTTGAGATCCGTGAAACCG ATGAACCAATCCGATGATAACCACACTCCTTACTTTACTAATATTATCCT ACCTCACACAAACTTATGGTTAGACTCAAAATTAAAGTCCAACATAAAAT ACTGTTTAATACATTCACTTTCTCTCATCTTGGATTTAGTTTGGATGTTT TTTTTAATTTCATGGAGAGCATAATTTCATGATGTTTAAATTTCAGGATG TTTTAATTTCAGTTTGCATGGATTTGTTATTTTGACTATGTTTTAATTTT GGGATGTTCTTTTTGGAAGTTTTGTGTTTGTTGATGAATGATGCATGTAT GGATCATGGATGATTGAAATATTTGAGTTTGATGAAGTTGTTTTTAAAGA ATGATTGATGAATGAATCTTGGATCATATGTATGAAATATTGAGTAAGAT TATTTATAAAAAGTTGTTTGAAAAATAGAGAACATGAAAAAACAAAATAT GAAATACAATTATACAAAGTTGTATGAAATATTTTCTAAGAATATGAACT TTTTTATTGTATTTTGTAACAAACCGATCAACCGAACCAATCCAAACCGA ACCAAACCGATTAGTTTGGTTCGGTTTCTTTTTTGAAAAACAGTGGAAAC CGAACCAAACCGAACCGATGAAGGTTTCATCGGTTCGGACATTTTTTTGA CAGAAAACCAATCCAAACCGAACCGTTACACCCCTAATCACATGTCATTC CAGCCACTCACATACAAAGTAAAATTGAAAATGTTGTTAGAAAGTAAATG GACTTGGAACTTTTTCTTGTGTGGTTTTTCTTTCGTCAACCTGCATTGTA GAAGATACTTGGTTCCAACTTTTTGATTATCAAAACTGAGTGGATTTGTT ATGATTGCAGTTTTCATGGAGTTCCTGCAGAGGAGCGCCTACACTGGCGT TCTTTCTTGGTCAAACTAGGAGCTGATAATCTTAAGGGTGTAAAAAATGA AGAACTCCTAGTTGCTTGCCACAAGTAAGTATACTGCTCTCGCCTCTCTC AAGTCATGTGTACGTGATGTATGAATGTGTATCTTACATGGATAAATTAC CTTATCTAGGTGAGCACTTTAACTTTATCTGATTCTGAACTGGTCCAAGG ACTAAATTTTAGTTATTAGAATTCTATTTGCAAGGTTAGTGGGCCGTTGA AATCTGTTTATATGAATGATTATCGATTCAGTGCTATGATAGTGATAGAC TTTGCACAGTTTGCATTTTGAATTTTTGTGATGCAAGTAGATGAGAACAA AGTGAATAACATTAGTTGATTACTAAGATATTTCAAATAGTATTATCATT AATGAAAAATTTGGAAAAGAGTTGTGGAAATGGAAGCTAAAAACTGACAT GTGAACTTGTCCCATCAAAAATCAGTAACAGATACAAGATTGTGGAATAA AAGAAAAACTTTTTTGCTTCACTGCTAAATGCTAATTATTGTTCATTAAT ATGCCTTCATTTTTGAAAATTATGTCTCATTCATATGTGATGATTCAGTT TCCCTTTTAGTAAACAGTGATTTATTATTTTACTTCTACTTCTTATCTTT ATCAGGTCAGTCTATATTGTATACACAGTACTTGGAGATGTCAGTATATA CGTTGTGGGGAAGGACGCGTACGATGAACTTGCTTGTATGTATTCTATGA ACCAATCTTTTTTATTTGATGACAGTAAATGGTAAAATAAAAGCAAACAA ATTACTCATCTCAGTTGTTGATGTTTTAATATAAAATTGCACAATATTTT GTACTTGCTGATAGTAAAATAAAACATATAAATCAATCATCTAAGTTGTT GATGCTTGAAAGTTGATTTGCTTGCTATTTTTAGATTGAATTTTGATAAC AACCCTGTATCCTATTAGAAATAAATAGGGACAAACCCCAATTACAAAGA TAGAATACTACAGAACTTCGGAGTCTTCATCTGCTTATACCCAAAGTCCC CAATTCTCTCTTAAATAACAAGATATCACTCCCTCTCGACCACTCTTGTT ATTTATAGGCAACATCTTTATTTCTTCTATTTATCTCAACCCAACTACCT AACCTTGTTACCAACAGCCCTTTCATCAACAATGTAGGTTCTACATTATT TGCGTGTCCTTGTCTGCAGTTCTGATTATTGGATCTCATCTTTTAGACAT CAATTCTACCTCCTGATGTGTTGATTATATTTTGTTGGCTAATCAACCAA GTTTGATTCTTCTCTGTTATTGTTGTGCCTAGCACCTGTGGCTTTGCTTC TCCTCATGCTGTCAATTGGGTTCCCTAGAATCTTGTCCATCCTGCACAAT ATTTCCCATACCATAAAACTAGCGTCCATCCACAACTGTTGCTCTGTTTC CTTTTCGATCTATTGCCTTAATTTTTGCAAGCTTCTCTTTGTAGCATCCC CTCAATCCACCAGTCTCGTTTAGCAATGAATTGCTCCCTAGAAAAGATGA TAAACTAGCTATTAAAGGATACTCTTGCGGTGTTGAAAATATGGCATTGC ATCTTAAATAATGTAGTGAGAAAAGCTAGCTATCAGGTGAACTAGTAGGG GTATATCTTAGAATCTAACTAAACTTAGCAGACAATTTTGTCTGACTTTC CAAGAATAGTATACATATTTAATCAAAAAACAAGGTTGTTCGTTCATATT GTGATTTGATGGTATCAACATTCATAACTATGCCAATTGCCGAGTGACTC AAGCATATTGTTATTTCACCAAGGGTTTGAAATTGCAATTTGGAAAAACC TATATGTTCGTAAGCTGTCAAGAACTTTCATAATTTTACATTGATAGTAC TAATTTACAAATGTTTTGTTTTTCTCCAGTGTCGGAGGTTATCTTTACAA TAACCTCAGCTGTAAAGGATGTATGTGGGAAGCCCCCAACTGAGCGCCGT TTCCTTGATAAGTATGGAAGAATTTGCTTGTGTTTGGATGAAATTGTATG GAAGGTGAGAAGACATGCCGGACAATGTTTAGTAAAAGATCACAGCTCGC TTTTGAAAATTTTCAGTTTACCCATTCATTTTACTTACCTTAGAGAAACA TCATTTTATGACATTCACAATTGTATATGCATCTATCTAGTTATTATAAA TATTGTTATTTGCTGTTTAATTATTTTTCACAAGACTCATTACGTATTCA CGTCAGTGATTATCTTTTGCTACTCAATTCACTTGAAACGATACTCCGTC TTATTTGAATAAATTTAAACTGAAGCAAATATCAAAATGCTACTAAAAAT AGACAAGTTTTCCCCATATTTTCATGCAAAACTTGGTTGCGACTTTTTGT CTCTGTTCACTACACACACTACTGATCCAATCTGTATCTTTTTGCATCTT ATGTACTCCTCTGTTCCGTTGTTGCGAAAGAGGAGTTTCTTCTTGATGTT GTGCTTACATTTTCCCTGTATTTCTTTTGAAGGGATATCTGGAAAATACG GAAAAAGATAGAATCAAGAGATTGATAAGGTTGAAGCCTCCTACTGAGTT TTGAATGAGAAATTCTGAGGCAGTCATTATAGAATCTGCAGTTTGAGTCG TGTGGTGAGCATCTTGTGACTTAGAAATGGCATGTAACCAAAGCCAGGCA AACCTCTTTGTATGATATTTTGTTCTCTAGAATGGTGCAGGCGAGGATTT TGCTCGGCCCATAAATACTTGCATTAACATTTTCAATTTTTTTTAATGTT TTAACATCTATATTGTTGATTTTGTTCTACATATACCTTGTGCAATGTGT TTATTTTCACTCTTTTTTGGTCTGCTCTTCTAAGTATATATATATATATA TTTTTTTTTTTTTTTGACAAATGCTCTTCTAAGTATATGTTTGTTG
back to top
Properties
Property NameValue
NoteClathrin adaptor complex small chain MAKER:28.1:0.2:Medtr2g103690
CADL Non-redundant FlagY
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of Medicago sativa2016-01-05
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Scc4a34_26supercontigScc4a34_26:335065..341060 +