MSAD_210027 (gene; Medicago sativa )

Overview
NameMSAD_210027
Unique NameMSAD_210027
Typegene
OrganismMedicago sativa (alfalfa)
Relationships

The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
MSAD_210027.t1MSAD_210027.t1Medicago sativamRNA


Synonyms
The feature 'MSAD_210027' has the following synonyms
Synonym
augustus_masked-Scc4a34_13-processed-gene-0.4
Sequences
The following sequences are available for this feature:

gene from alignment at Scc4a34_13:20764..21303-

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>MSAD_210027 ID=MSAD_210027|Name=MSAD_210027|organism=Medicago sativa|type=gene|length=540bp|location=Sequence derived from alignment at Scc4a34_13:20764..21303- (Medicago sativa)
ATGAAATCCACAACACAAACATCATTGTTCATTTTCTTCTTGTGCATCAT ATTTTATGCTCCTCTTCCAGCAATATCAGTCAGCTTGTATGAATCTTTAT GCAATGAGTACAGCAACCCTAGCAGCAATATCAAATTATGCTTGAATATA TTGAAAACTGACCCAGAAATCACCTCAGCCACAAATTACCATGACCTCTC CTTGTATATCTTGGAGATGGTTCAAAAAGACGCAGCAGCGGTTCAACTTG ATCTTTTTGAAAAGAGAAAACTTTTTCCCACTGATCCAGCTCTTAACAGT TGTGTTAATGAATTCTATGAAACAACTATTAATGAATTACAAAAGGCATT GCGTTTGTTGCCAACTGATCCTCAAACTGCAAGAGATAGTGCAATAGCTG CTGGTTTTGGAGCTAATAATTGCGAGAAAGCTTTTGAAAAACCAGAGGAA AAGAATGTTCGTGCTGCAATCCATCTTCGAAACAATGATATCTTTTTTCG ATGTGTAATTGCATCTTTATCTATAATTCATCTTATGTAG
back to top
Properties
Property NameValue
NotePlant invertase/pectin methylesterase inhibitor protein MAKER:6.1:0.37:Medtr6g034800
CADL Non-redundant FlagY
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of Medicago sativa2016-01-05
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Scc4a34_13supercontigScc4a34_13:20764..21303 -