MSAD_210026 (gene; Medicago sativa )

Overview
NameMSAD_210026
Unique NameMSAD_210026
Typegene
OrganismMedicago sativa (alfalfa)
Relationships

The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
MSAD_210026.t1MSAD_210026.t1Medicago sativamRNA


Synonyms
The feature 'MSAD_210026' has the following synonyms
Synonym
maker-Scc4a34_13-augustus-gene-0.48
Sequences
The following sequences are available for this feature:

gene from alignment at Scc4a34_13:10100..11088-

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>MSAD_210026 ID=MSAD_210026|Name=MSAD_210026|organism=Medicago sativa|type=gene|length=989bp|location=Sequence derived from alignment at Scc4a34_13:10100..11088- (Medicago sativa)
ATGAATGGTATTTACTATTTAGTTCCAACATCTGTTAGTAGCCCAACCCT TGGTGATTTCCTGTTCGACATTGGTAAGTAGCCTATGTTCATGTATAAGC TCCACTTCAACTCTAAGGCCCATTTCTTCTTTTCAATATTCCGGTCCTGA TCAATTCATCTCTCCCATAGGCTGATGTTTTCTTTTCATCAAAATTGGCT TGGCCCATTAAATAGCAAGCGGGACTTCAGCTTCTTCACCTGGTTGTAAC ACGTTTTACTGCATAAGGAATTTCCAAAGACCTCTTGAAGTTCATCCACG CCATCCTCTTGAGTGGCATTGTTGCCCAAAGTTCCTTGTAAACTCTGCTT GTTGTCAGTTGATTGACGAATCAAAGACGCATTTATATTTGCTTTGTATA AACTGAGCACTTCTTTTAATCATCTAGAATATTAAATATGCATAATCACA TTATCTCTAGAACCTATATACCAATGTTTTTCTCAGATGTGGTTCCTCGT CACGAGGATAGGAAGGGTTAGGTGTTCAATGAACTATTATAATTTAATAT ATAAAGAAAATTACCAACTTTCTCAAAAGCCTGGGGTAATCCATTTTTCA TTTTTCAGATTTTGTGAAGGATTCAGAATTGCAGTAGCAAGTTGTGTAAT TGGATTGAAATTGTTTTCTGATTATTATAACCGATTAAACTTCTAGAAAC TACTGTGGTATGTAAACTTCTAATTCGCTTAAACTTTTATTTTGCAGGAC TCACTAATTAAACCGATTACCAGGATCTTGATTGGGGTAGCAGTAATAAC CCTAATGATAGTAATAGTTTCGAGGGAAAGTCCAGAATGGATGAGCAAAT TCAACTTTTCTCCTGGGAACTTCTCTCCATGGGTCTTGGCTTGCGTAGTT ATTGTCTTCACCCGCATGAGAAAGAGAACAAAGGATTTTCTAACAAAGCG CGGTTGGTGAATCGACTCGTGTTGATGCTTTTGTCGTAG
back to top
Properties
Property NameValue
NoteUncharacterized protein MAKER:25.8:0.59:
CADL Non-redundant FlagY
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of Medicago sativa2016-01-05
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Scc4a34_13supercontigScc4a34_13:10100..11088 -