MSAD_210025 (gene; Medicago sativa )

Overview
NameMSAD_210025
Unique NameMSAD_210025
Typegene
OrganismMedicago sativa (alfalfa)
Relationships

The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
MSAD_210025.t1MSAD_210025.t1Medicago sativamRNA


Synonyms
The feature 'MSAD_210025' has the following synonyms
Synonym
maker-Scc4a34_13-snap-gene-0.58
Sequences
The following sequences are available for this feature:

gene from alignment at Scc4a34_13:782..4868-

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>MSAD_210025 ID=MSAD_210025|Name=MSAD_210025|organism=Medicago sativa|type=gene|length=4087bp|location=Sequence derived from alignment at Scc4a34_13:782..4868- (Medicago sativa)
ATGGAATTCGGAGATGTTCGTGAATTTTTTGCAGGAAAGACCATTTTGGT TACTGGTGGAACGGGATTCATAGGAAAAGGTATATTTTTTTTTGAAGGTG AAGATCGTAAATTCAAATAAAGTATTTTCTTCTTTCACATTTTTATTATT ATAAAATTTTCATACTAGGATTCAGCTTTTTTTCTTCAACGCAATAAATA TTTTTATGCTTTCTTTTTTTAGACAAACCTCAACGCAGTAAATGTTTTTA TGCTTTCTTTTTTTTCTTCTCTAATGCATGCAGTTTTTGTGGAGAAGATA TTAAGGGTTCAACCGGACATAAAAAAGTTATACCTTCTTATTAGATCACG AAATACTTGTTTAGCTACACAACGCTTGCAAGTTGAGGTACGAAATTCGA ATAGTTTGTTTAATCATACTTGTTTGAGTCATACTTTCTTTTAAGATAAA TGTTAACAAGTATTATTATGACATTTAAAAAAAGTTTATAGTCAAAAATA TTTTCTTGAGATTTGCATAACTTAACCGGTAAACTCCGCGATCAACACCA CCTCCCCACTCCTAAATTGTGATGAAACACACTCCGCAAAACCTTCGCCC AAAGCGTGATGAAACCTAACCTAAGACACACAAAATAGCTCCCCCCAAAG CGTAAAACGAATTCACCGTATCATCCAAGATCACCCTTTTCTCCGTTAAA GAGCACTTATCATAGACATTAATCACATAATACCTTGATTTTTCAACGCC TCAATCTAGGCACATCACCAGATAGTCAGGGCCCCAAAAAGAGAAGACCG AGGCCCCATTAGCTTTAAACCAAATAGATAGAATCCCACCACTGTTGCCA ACAAACGAAGTGAAACTCCACACACAAAATTAATTCCCTGAAAAGAGAAA AGAAAAAACCATCATAAATATGATCTAACTTAGTTTCATGTATAGAGACA AAATCAAGATGGTTAGATGCAATGAAGTCAAACACTCTTCTTCTCTTGAT CATACCTCCTAGTCCTAGCCCTCTAATAGTAACCCTACAATCATCTATTT ACCTTTATTGACGCCCTACACATATTTTTCCTCAAAAACTACCAACCTAC TCTCTCAAAACTATTCTCCCTACCAAAAGAATAGCCTAACCCCTTACCTT AAATCTAAAATAGTATGGGCAATAAAAGGAATGTGTGAACCTCTTGAAAT CCCCATGAAAGGAGTAATAGGCTCACCATGGGGACGAGATACTAGCGGGG GAAACCCCTTAACATGAACGTCAGAGTCAGGGTCATTCCTACGAATTCGG AGGCTAGACTCTGTAAGTGAATAGAGGTCCATAATAAAATAAAAACATTT TTTTTTAAAGAACAATGCTCTATTTAAATTTTTTAAAAGATATATTCAAG GTGCCGTATATATGCGGTACACCAAAACGTGAAAATCACTACGGTATACA TGAGAAACCTCAAACCACCCTAAAGAAAACACCCACCTAACACCAAAAGG AAGAGGGCCCAATTCTAATAGACCTAAATCAAGACAATAGAAGAGAAAAG AAGAAACCGGCACGGAACCACCAAAAGCCATGTGCCAACAAACCTTACAG CACAACAGCCAATAGCAGTCACAACAACATTTTTTTTTTAGGCCCATACC TTAGAGAGGTCCAGCTCCATTGAGCTCTTTGCACCCCTAAGGTCCAGCCC TGGTCTGAGTTAAGACCCAGATACATACTTGCCCCATGAGGTGTGGGTGA ATGACTATCTCATCTTATGAACATAAATGGATAGAGTAAAGCGTAGGTGG TGTACCTGACAAGCTCCACTCTCCGTCCTATCTCTATGATTCTCCACTAA GCCTTGGAATAACGGGAACTTCACACACAAAATTGCCTTTTTCATCTCCT ATTCCTTTTTGGCAACACATCACAGGAAACAAACAGTGGCGGAGCCAGAC AAATTTTTTTGGGGTGGCCGCTAAAAAATAAACTAAAATATTTAAATCAT ATTGTATACAACACCCTTAATCTTACTTAATATAAATCTAAGGTGGTCTG ATTTCCCTAAATCCCTAACCCTAATGCAGCCCTAACACCCTAAAATGACA AATTTAACCTTGAATAAGAAGCCTTTTCCCACCTAAATCATCACATTAAT GAGCAACTAACTACTACTTAACACTATCTTCACCAATTTAATTTTGCGCG TTTTTTGCTACCTAGAGCCATGCCAATAATAAATGCAAAGATGAAAAAAC GTGCAAGACGCGGGACTCTAGAAGTGTTTAGTTGCACACCTTTGTGACCT AAAACTAGGAGACATCATTTAATTCTTGGTTTTTTTTTTGTGTTTCTGCA TGTTATGTTCACACCATCTAAGAACCTTATGTCATTCCTATAAATTGGTG ATACCATTTGGTCTGTTTGGCTATTATCTCAAGTTAGCGCACCTGCATAC AAAAGCTCAGTAAAGAACATTTGATATCTTGAGCTCTTTTTAAGCGCATT TATGGCAACCAAAGGTCTGTATTTGCCTCGACCAATTTTTTCACATGGAC AAATATATGTTGCACTGTCAAGAGTTACATCAAGGAAAGGCTTTAAGATA TTGATTATTAATGATGAAGGGGAAGATAGTTATGTCACATCTAATGTAGT TTACAAAGAAAATTTTCAAAATGTACTTTGATTTTTTGTTTAACTGTTTG ACTTTCTTATAAAAAAATCCATGTATGTCACATTGATCAATGATACATGA TATCCTAGAATGGTTTATTTTTCAATTTTTTTGAGTTGATTGTAATCAAA ATATATTGATCAATAGTCTATAACAGACCCGCGCGACATAGACAATTAAA TCAAAGAATCAAACAAAAATAAAAAAATAAAAATATCCTCAACTTCCTCC AAAACCACCTTCAAGTCTTCACTTTCTTGAATATGACAAACCAAAAACTT AACCATTGTGATTGAGTTTACTGGTAATAAAACGTCTTCCATCACCGCTA AGGGACCAACATCTTCACGAGCTGCCTTGATCGTTAAAAAATGAGGAACA TATATGAAATAGAAGGTTGTCATTGCCTTTTAAACGTTAAAATTCAGAGC AGCACACTTTTTTTATTTGATGGTGGCGAGGGTTTGAACCCCGGACCTTT GCATATTTTATGCATTTGTTCTTACCAACTGTGCTAAGCTCACGAAGACA GAGCATCACACTTTATCACTGCACATGTTTTTTTATTTTATTTTTTGACA CATTTATCGCTGCACATTTTTTTTTTTAAAAACTCGGTGTCCGATTCAAG GACCGACTAATCCGAGGGGACCAATTCCACCGTCCACTTGCGGGGGGCCA CGTTCTAAGCTAGAGCAAAGTTCGGTATAGACTTGCCCGCCAAAATTGGC ACCAGAGGGAATCGAACCTGAGACCGGAGTACACTCCAAGATCCCAAACC AACCACTAGGTCAACCCCAAATGGGTTTATCGCTGCACTTGTTAATTCCC CCGCTCAAGCCACACCAACCTTAAATTTATTATTATCTAAAGTAATTATC CATTTTAGTAGAACTATATCTATCTATTATATATAGAGATTTGCTAGAAC ACACCCACTATTTTTATGTGGGAGTGTTTTAACAAGCTACACCTTAAGGT GTATTTAACTACTTTTTAGTTATAACTTGCTAAAACACACCTTCTAAAAT ATAAGTGGGTGTATTCTAGCAAATGCCTATAGGAGTTGCTAACATACACC CACTTATTTTTTAGAAGGTGTGTTTTAGCAATATTCACCTTAAGGTGTGT TTAACAACGTTTTAGTTATATCTTTGCTAAAACACACCTTAATAAAAACT AGTGGGTGTATCCTAGCAAACCCGTTATATATCCAGGTCTTTAGGAAAGA ATTGTTCAAGGTGCAAAGAGCTGAAAAGGGTGCAGATTTTGACTCTTTTA TATCCGAGAAAGTGGTTGCTGTTGTCGGTGATGTAACTCTAGAAATGTTG GGAGTGAAAGATGTGAAAAGGAATGAGGAGATGTTGAAAGAGATTGATAT AATAATTCATTCTGCTTCCATAACCACGTTTAATGAG
back to top
Properties
Property NameValue
NoteFatty acyl-CoA reductase MAKER:8.5:0.24:Medtr6g034660
CADL Non-redundant FlagY
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of Medicago sativa2016-01-05
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Scc4a34_13supercontigScc4a34_13:782..4868 -