MSAD_210023 (gene; Medicago sativa )

Overview
NameMSAD_210023
Unique NameMSAD_210023
Typegene
OrganismMedicago sativa (alfalfa)
Relationships

The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
MSAD_210023.t1MSAD_210023.t1Medicago sativamRNA


Synonyms
The feature 'MSAD_210023' has the following synonyms
Synonym
snap_masked-Scc4a34_10-processed-gene-0.5
Sequences
The following sequences are available for this feature:

gene from alignment at Scc4a34_10:11798..14202-

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>MSAD_210023 ID=MSAD_210023|Name=MSAD_210023|organism=Medicago sativa|type=gene|length=2405bp|location=Sequence derived from alignment at Scc4a34_10:11798..14202- (Medicago sativa)
ATGAAGGTTTGTTGTGTTGTTGGGCAATTTTCATCTCACTTCTCAACATG CCTTTCTCACAATAGGGTTGGGTCTTTAGTCAAAGCCTATTTTTTATTTT TTTCTACTAGTTTATCCCTATTGTTTACTGCATACCATTTTGGGCCACCA TTTTCTCTCAGTTTTGGAATTTAGATTTGTAATTCAAATTATAGTAAAAA AATTCTTATCTTGAGTTTGAGGGGGGACGTGTTAAAATAGTTGGAAGATA GGTACAGTTAGTTAAGGTAATTAAAGTTGGTTAAATGTTAAGTAGGTAGT AAGATTTGGTTAGTCAAGTAGTTAGTGTAATTGAGATCTATAAATAAGAC CATCCATGTACTTATTACCCATCTTTTTATTAAGAGAAATGATATTTGTA AAACCACTTTATTGCAATTTTTTGACAACTTTCTCTCTCATACTCACATT ATATTCTTATTTCTCTCTCCTTTTACTCTCTCTATTGTTTTGGACCAATG AAGTGATAAATATTACATCAAATTGTCCAAATGTTGTAATTATCACTACT TCTTTATTAAATGTATCAATTAATCTTCTAATCAAAGCTGAACTCTTTGC TCAATATTCCATTCTCAACTCTAACATTAAATTGAATCACATATATAAAT TAAACCTACTGGGGTTTATATGTTGCAGAGACTTTGACAGTTCTTTAAGT ATCAGTTCGATTCTTCCCAGTATAATTTAGGTGGACTAGTTTGCTTCTTA AAAAAACATAATTAAATGTATACTAATGATACTGTTTAACCGACTTCTCT CCAAATAGTTGGACCTCCTCACCTTATCGCTCCCCCTCTCTCTAACTTTT CAAACTTTCCCAAACAACCTACTCTTTCCTTGCCAATCCAATCATTGCCT CTGCGATGTAGATCCAAGCATCTGATGGTGTGTCCGGCTTCACGGCGGCA TCACCATCTTCGTTCCAAGCTTTGGTTCGTCGCTCTCTGCCGCCATATGC TCGTTCTGTCCCGCCGTCCCTTGAACCCACCGTCGCCAACTGCGGTCTAG TGGTGGTTGGCTCGGTTCTGGTTGCTGTCGTTGTTGTTGTCTGTGGTGGT TCGGTTGGTCTTGAGAATGGTAGAGAGGTTGTGACGCTACTGTTGCTGGA TAGTGCTTTTGTTTTGCCTTCTGCTGTTTTTTTTGTTTGTGTTTTGTTGA TTTTAGGTGTTGTGCTTATGTTCGTTTGTTCTGGTGCTTGGTCCTGGTTG TTCCGATTCTGACGGCTGCAAGTGTGGTGACTTTCCTCCACGATTAATCC TCCCTCGTCGTGCTCCCGGATCGTTCGTCGTCATTTGGATCGTGGTGGTT CTGTTTGTTCTTGCAGGTGGTTGTGGTGGGCGCCGGTGGCCTTGTATCAT CGTGTGTTCGGTTTGTGTTTTCCTTGTGCTTGTTCTTCAGAGGTTGGGAG GTTGGGGAGGGTTGCGGATCTGGTCCTTTTTGCAGTGGTTGTGGTTCATA AAACCTAAAAGGGTCTGGTTCGTTTAACCCGAAAGGGTCTGGTTTCTGAC GTATTGAACTCATCCTTCGATCTGAGTTTTTACGCGTTGTTTGCTCGAAA GAGCATTTTATGCCTGCTATTGATTCAGGGGGTTGTTGGCACTTGGATTG GTTTCCGTCTTGACGGCCAATCCATTCGCCTAGTTTAAACTCTAACTGTT CTATTCAGACGTCCACTTTTCATGTGTCTTTTTTGTAACCTGGTTTCGCG CCCGTACGCGGGTTCGCTGAGTTGCGCTAGTGATTAGTGTATTTTTGTTA AGATAGATTAGAGCTGTACCACTTGGACAGTTTTTTCACGATGTATTCCC GTTTGAGTTTTCTTGGGTCAGGTCCAATGTCCCCCCAATTTTTGTACCTG TTTGTTTTTATTTATTATATTTTCTCTTTGGCTTAAAAAAAAGTATATTA ATGATACTGTTGTAAAAATTAGGACTAAATTATCTCTATAAATAATAACA TCATATAAATAAAAGCATCAATAAAATATTAAAGAGAATAAATAAGAGAG ATTTAAGAAAACTTATCTGTTCTTGAAATTGCGGTGATTTGCAGTCGACA GAATCGAAGTAAACTAACACAAAACCATGGAAGGAGATAACCTGCCAAAC AGTAATCCATTATATAACATGAGGCGTAACAAAGTCACTGTCCTTAAGGA TTTATCCGCCTCATAAGCGCATCTCCTCCCAGGATACAACATGTTCTTCC CTAATATGAATCATATCAGAGGTGATAGAACAACTTGAATCTGTTGGAAC ACTGGAAAAATGTTACCCAAAAAACTCAATATTTTTGAGAGGAGAGAAAT CAATTTTTGTTTATGGTTTTTTTAGGAGAGCAGTGTTTCTCATCATGTAC TGTAG
back to top
Properties
Property NameValue
NoteTransmembrane protein putative MAKER:33.0:0.37:Medtr8g099425
CADL Non-redundant FlagY
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of Medicago sativa2016-01-05
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Scc4a34_10supercontigScc4a34_10:11798..14202 -