MSAD_210021 (gene; Medicago sativa )

Overview
NameMSAD_210021
Unique NameMSAD_210021
Typegene
OrganismMedicago sativa (alfalfa)
Relationships

The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
MSAD_210021.t1MSAD_210021.t1Medicago sativamRNA


Synonyms
The feature 'MSAD_210021' has the following synonyms
Synonym
maker-Scc4a34_10-augustus-gene-0.7
Sequences
The following sequences are available for this feature:

gene from alignment at Scc4a34_10:88..858-

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>MSAD_210021 ID=MSAD_210021|Name=MSAD_210021|organism=Medicago sativa|type=gene|length=771bp|location=Sequence derived from alignment at Scc4a34_10:88..858- (Medicago sativa)
ATGGATGTTGATTCTGAGGATGATCAAGATGATCAAGCCTCTGACATGGT TATAGACACTTTTTCTGACCAACCTTCAACCAGCAATCCTGAAACCACAA ATGGCCAATCATCATCTCATCTAGCCATTGTACCTACAGCTTCACCAAAA CCTTCTAAACAACCTTCACCACCCACCAGATTCCTGGGTCCACATGTATT ACAAGGTGTGTGTGAGGACATTGCTGCTGAGTTAATCAAGCTGATAGAAG GGAGAAGTGACTTGGGTCACAAAGTCAGTTATCAAAAGCAGTGGAGGAGA CTGAAGTAAAGAGTTCTTAATGTTATTTCAGCACTGCATGATTCCTGTAT TGAAGCTCAAGAGCAAGCCAAGCAGAAGTTGGAAGATTGACTGAATGGTG TTGAAGAAAGTCTTGATGATATACATGTCCTTGGAACCTGGGTGAAGAAT CCACTGAGCATAAGAGGAAGAGATCCTACAAATTTTCTTCCTAAATTTAT TCACCCTAAGGATCTGGATTTGTCACTCCTTTCTAAGGTCAATTTGAGTA AGGCTGCACCTGATCTGGCTCTAGTTCAGAAGAATAAGGTGTTAGAAGAA AGGAACAAGGAACTGGAAAGAGAGCTACATGAACATAAGATAATGTTGTT AGAGTTCAAAGCCGAAACAGATGCTAAGCTGGAAGAAGCTAGACTCAGAG AAGAAAGGCTCAAGTCAGAGATGGATCATAAACTTGCAGAAACAAAAGAG CTACTGAAGAAGATCTTATAG
back to top
Properties
Property NameValue
NoteUncharacterized protein MAKER:0.0:0.35:Medtr7g047000
CADL Non-redundant FlagY
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of Medicago sativa2016-01-05
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Scc4a34_10supercontigScc4a34_10:88..858 -