MSAD_210014 (gene; Medicago sativa )

Overview
NameMSAD_210014
Unique NameMSAD_210014
Typegene
OrganismMedicago sativa (alfalfa)
Relationships

The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
MSAD_210014.t1MSAD_210014.t1Medicago sativamRNA


Synonyms
The feature 'MSAD_210014' has the following synonyms
Synonym
maker-Scc4a34_9-snap-gene-0.6
Sequences
The following sequences are available for this feature:

gene from alignment at Scc4a34_9:3487..3818+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>MSAD_210014 ID=MSAD_210014|Name=MSAD_210014|organism=Medicago sativa|type=gene|length=332bp|location=Sequence derived from alignment at Scc4a34_9:3487..3818+ (Medicago sativa)
atggaagtcgtagatatgctcgttagatttcctaggaactattacatgct tcgattcgataaggctaggccactttatgccctttttagtgaaagaaaaa ggtcaaaaacgagtaaaatccgtaaattaacaaggaaattcacttaaccc cattttggccgtttttgaaaattctaaaatcaaccatggaagtcgtagat atgctcgttagatttcctaggaactattacatgcttcgattcgataaggc taggccactttatgccctttttagtgaaagaaaaaggtcaaaaacgagta aaatccgtaaattaacaaggaaattcacttaa
back to top
Properties
Property NameValue
NoteUncharacterized protein MAKER:0.0:0.51:Medtr2g084470
CADL Non-redundant FlagN
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of Medicago sativa2016-01-05
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Scc4a34_9supercontigScc4a34_9:3487..3818 +