MSAD_210005 (gene; Medicago sativa )

Overview
NameMSAD_210005
Unique NameMSAD_210005
Typegene
OrganismMedicago sativa (alfalfa)
Relationships

The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
MSAD_210005.t1MSAD_210005.t1Medicago sativamRNA


Synonyms
The feature 'MSAD_210005' has the following synonyms
Synonym
maker-Scc4a34_6-augustus-gene-0.9
Sequences
The following sequences are available for this feature:

gene from alignment at Scc4a34_6:10743..13377+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>MSAD_210005 ID=MSAD_210005|Name=MSAD_210005|organism=Medicago sativa|type=gene|length=2635bp|location=Sequence derived from alignment at Scc4a34_6:10743..13377+ (Medicago sativa)
gcagtaataattttggcttgtttaacccttgcagtggttgactcgacgac aagcacacttagtgcgtgcccaacagggtatccctctgtctgaatacggg gtaagatttgccttcattgcaatataattagctgtttagttacatatctt gtgaaaactgttttttttatagcagtatttctaataatgtccttaaaaca tggatttttcccccataattgtccccctataaagaaaagggcagggagta ggacagtattttaagttctatcttgaatccgtaactggtgcagtactgca gtcaatcattattcatttgttaacattggcataaacttgtaatctgacga catggtatgaagcttgcttttcagctggtgccatgcatctgataccggat aatacacttttagatatgggtataattctttttaacatattagtctgttt tgattttgtttaccatacatgtttccattttatgaagttaaaaactagca atccctgcaaactgcatgttggattgcttggaatgtgatagattattatg tttaaacaaatttttcgtgattatataatgattatatttacttttcaccg tcagtagctggtttttatctgttctgcataataacaaggttctagggcac atatgttatgggcacagtcccatgtatgtcatgtgggttgtaagtcttcc gccttcctcaagacatttatttttcatcagaggaaatctgtttcgaagct catactgttggattctttctggaggcatcacaatcagtattgctttatct tatttcagagattgtacatatggggttgattgaatcattgaagcataatt tgtgatcatattcttagcattctcaatgtatattcatttctgtttgatta tccacactacaacaattagatggtaacagttgctatttttcgttttgtta gattttggtcgatatgattcgcgtgcctgattgggcatttgaagctgcag gtcaagaaacaaggggcatgggccaagatactgcttcatatcatccagga ctttacctaacaccggctcaggtagttttagttgatgtttgcggacttgt tgatttcatattagaactcatgcaaagcagcagaatgtttttctttgaaa agtagagtgaactgtattgtcatgtagattaattagctgcgaaatatttt gccttaattatgtagagggagaggaagacctaagaaaaccattagagaaa accattagaaaagatttagaggtcaatgaattggatccaaatatgatctt tgatagaacactatggcgtcatttgatccatgtagccgaccccacttagt gggataaggcttgttgttgttgttgttgttgttgtatgctattattcata tggttgtgttttcagacaatatgtttgctgttgttatgccatatatttat ctcaatcaaattccttttgtatatttatattcaatttcagtgctgataat aaggtttcatgtctgggttggatgcagagagaagcagtcgaagctttaat tcaggaactcccaaagttcaggttgaaggctgttcctactgattgcagtg aatgccccatctgcttagaagagttccgtgttgggaatgaggtatacttt tctaaatccaattaaaggtctagagcaagtcatactaattaccatgtgct gtttgccatctgatactgaaaataattctccatttaacctcgagaactct ttacgttaaagatgtaatgtgtatcttcaagtgatttaaaaatagtccca ctgtaatgcaggttcgtggcttgccttgtgcacacaattttcatgttgaa tgcattgacgagtggcttaggctgaatgtgaagtgtcctaggtgccgttg ctcagtgtttccaaatcttgatcttagtgccctgtccaatctccgtcctg attctgaacgatcttctgccagtgttgtgacaacaactagatacgttaga ggccaaccttctagtcaaagttacttgttaaggttacaggggcttctccg ccctgtgcgtgctgaaattgcagggccagttgatgacacagataatgctt tgcaaaatgctgagaacggtgttgcacctgttttgacacaaaatgcacca aacagagtccagggctcaacggtggaatgcatgcctgtcagtctttcttc tgcacaaagttagattatgtagttttaagctttgactagaataggttaaa gaatgcacatccacatctgggctgtaaaaaaatggttcacattctaacat gaaatttttacattgatccatgaagaaatgggtcagtttctttgtccggg gcttcttcaagtggcgcagtaggacttggaaaatcaaggtataccttttt gctttactaacctagatcagaactgcagatctgtaattgtctttttttct tttttccttctagccttttatgtttgatcaagtgtaaaaagagtttgaaa ttctaatcagatggagtatgtgttcctttacctgttccattttgttgggc gtagtattactaatactattttattgggagagggtgatataggcgtagtt tttttatttttctttctaaatgagtttgtaggtga
back to top
Properties
Property NameValue
NoteRING-finger ubiquitin ligase MAKER:10.3:0.06:Medtr4g106960
CADL Non-redundant FlagY
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of Medicago sativa2016-01-05
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Scc4a34_6supercontigScc4a34_6:10743..13377 +