MSAD_210004 (gene; Medicago sativa )

Overview
NameMSAD_210004
Unique NameMSAD_210004
Typegene
OrganismMedicago sativa (alfalfa)
Relationships

The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
MSAD_210004.t1MSAD_210004.t1Medicago sativamRNA


Synonyms
The feature 'MSAD_210004' has the following synonyms
Synonym
maker-Scc4a34_6-augustus-gene-0.8
Sequences
The following sequences are available for this feature:

gene from alignment at Scc4a34_6:3767..5332+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>MSAD_210004 ID=MSAD_210004|Name=MSAD_210004|organism=Medicago sativa|type=gene|length=1566bp|location=Sequence derived from alignment at Scc4a34_6:3767..5332+ (Medicago sativa)
atgcctccaccacgcttaaaaccagtactatttgtgagtcggaaatcaga gtttagagtatgggatgataaacaccacccgtggaaaacctctgtggata atggtttatctgatagagggaagaaacagagtatcagagctgcttttgat ttgaaagaaatgggtgcttgtgataataattgttggatttggcctgctat tactcagagagcttatcaaactctgaattattgcttctgttaattctatt actagaaggttgttatgttggtttttttagttgttcttgttaatattgat gatgtgttttctggttttaattttgggattgtgaattgtttgatttcagt tatattgttccggaatacagctttcttgatgccggggattaggtgcttat gaaggaaaaactttagaatatgtttcagaagtaagattctcactccatgt actgttttatttactttagctatgttatatgatgacttctagttgaaaaa tgtctcatgcagactgtagtaggttgattcttgaaaattatccgaaactc taataataattgttgtcggtcctcctaacaagaatctcatgtattactcg tcctggttactaagaaggtgatttaattggtgttggtttgacaaaaaaag aattttaatgtcttgagttgaaactcaactcaagttcatatctgttttct ttgtttttgtcgaatcaacattgatcagatcaccatcttattcataagaa actacggacacgagaaccttgaacttctacttaaaaatgggaatgttgat cattgtcaaaattttaagcgattttcaagatcagtgcactatagatcgca tgcatgtaacactttcacactctagcttatatatgtatttcattacaaat acgattacaatttcactatgttgtggagctaagcataaattttgcaatga gattaaaaatgtgtaatggtggtgcagatatatgcatcagatggtatatc tacaaaataaaacctcctcccattgatgacggaactccaaatgagagtgt tgcagatgtttttgttcgtgtgacccaactcatgtcaatccttgaaactc aatacgctggtgacacagtcgttatagtctcgccagattcggataacttg tcaatccttcaggctggtttggtaggcctagacttgcgaaggtaactaac caactaactagatactccaacctcaaccaaccaaagcctctgcaattata tatatgagtttaattttaattctgtatcacattcattttgtttcttattt acaagtgtctcaaattcaggcacagggagttgtcttttgcacctggtgaa gttcgccaggttgataccaatgacattcctacttacaagatgcctccatc tgctgtatataaatgctccagctaccaattgtaattagctcttttattcc ttcaccttatataccaataaatggacatgtatagctcaagtttgtacatc tgtgtttttaatatttattgtaatactttcctgacagaaaataaaattgt tattatgttgattaaa
back to top
Properties
Property NameValue
NotePhosphoglycerate mutase MAKER:12.5:0.18:Medtr4g106970
CADL Non-redundant FlagN
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of Medicago sativa2016-01-05
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Scc4a34_6supercontigScc4a34_6:3767..5332 +