MSAD_210003 (gene; Medicago sativa )

Overview
NameMSAD_210003
Unique NameMSAD_210003
Typegene
OrganismMedicago sativa (alfalfa)
Relationships

The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
MSAD_210003.t1MSAD_210003.t1Medicago sativamRNA


Synonyms
The feature 'MSAD_210003' has the following synonyms
Synonym
maker-Scc4a34_3-augustus-gene-0.14
Sequences
The following sequences are available for this feature:

gene from alignment at Scc4a34_3:15685..16799-

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>MSAD_210003 ID=MSAD_210003|Name=MSAD_210003|organism=Medicago sativa|type=gene|length=1115bp|location=Sequence derived from alignment at Scc4a34_3:15685..16799- (Medicago sativa)
ATGATTGAAAATGTTGAAGCATTGTCGTCGCAAGTTGAGAATTTGAAAAC TCGGATTGATAGCGTGAAATATGAAAATCCTGGAAAGTTCTGTTCTGCAA CTCAATCGAACATAATTGGGCCGTCTAATGGATTTAATCGTTCTGTTCAT AATTATGGCTCTTTTGCTGGTAAAGAAATTCCAGTTCCAGGTAGTTTTGC CGGTAAATCTGAGTTATATGCGGAAGATCAACTTATGACTGACGATGTAT TATCAACTCGAGAAGGGATAACTCCTTCCATCGAATCTGCCAATAGGTCC CAGTTTGAGGTTCAGGGAGAAAATGTAAGCTTCATTATTTGAAAGTTATT TCAGCAATTTGTATGTCATTTGTGTTTTCCATTTTGATTGCATAAGTTTC CACTGCCTGCACCATGCTATTGGTTTTGTTTAGTTTTTATTGCACAATCT ATCCATCATCCATGAAGAAAGTTGTTCACAATTCACAAGATTTTAGATTC CACAAAGCTTTTATAATCCAGTTTTTGTTAATACTCATTTCTTGTTATCC CAAATAAATGTCCTTGGTATCTTGGTGAATGATTTTAAATTTTTCTTATG CACGTGTATAGTAAAATACTCTTGACCTGTCATGTATATAGTAAAATACT CTCGACCTGTCATAACCCGGCCATGTTATCTGTATTCTTTGTTGTGTACT TTTAAGTGTTGCCAACCGCGTATCACAGAAAATTGTAGTTTGTTTCAAAT TCTCCTACACCACAATGTTATAGCCCCGCTATAGCCTTTATTTGACAACA CCACTGGTACCTTTACTTTTAATGTTTGGAGTTGATAACAATAATATATT AGTCATGTACCCATTTGTCGTATAATGGAAAACTTTGTCCAATTGCTCCG CGTAATAGGATTATTGCAGACATCATAAATTTGTAACGTTGTCATTTTCT TGTAATGTTATGATTCAGCTGGAAGAGAAATCCAATGAATCAGTTGAAGA GCAGAAATGCATTTCTTCAGCTCAAGTTTCAGACTCTGACATGCTCACTG AGAATGCTGTTCTTAATGCTCATTCTGTTAAACCATGTTCAACATCCAAG ACTCATTTTCTCTAG
back to top
Properties
Property NameValue
NoteUncharacterized protein MAKER:14.8:0.5:Medtr7g007590
CADL Non-redundant FlagY
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of Medicago sativa2016-01-05
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Scc4a34_3supercontigScc4a34_3:15685..16799 -