MSAD_210002 (gene; Medicago sativa )

Overview
NameMSAD_210002
Unique NameMSAD_210002
Typegene
OrganismMedicago sativa (alfalfa)
Relationships

The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
MSAD_210002.t1MSAD_210002.t1Medicago sativamRNA


Synonyms
The feature 'MSAD_210002' has the following synonyms
Synonym
maker-Scc4a34_3-snap-gene-0.16
Sequences
The following sequences are available for this feature:

gene from alignment at Scc4a34_3:3953..12711-

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>MSAD_210002 ID=MSAD_210002|Name=MSAD_210002|organism=Medicago sativa|type=gene|length=8759bp|location=Sequence derived from alignment at Scc4a34_3:3953..12711- (Medicago sativa)
ATGGAAGTATCAACTCAAATTGCAACCGCTAGAGTATATCTGCAAGCTTA TGTTTCCACAAACTTAAAATTATAACAAAACCATTTTCCTGTTGAAATGG TTTCTATGGTTGTACTCCAAAACCATTAGATGTACTTAATGGTTTTGGAG TACAAATAGGAGAATCATGATATTTGAGGAGGAAGCAGCTCCAAACTTTG CCAGAAGTTAACACAACTATTACCTTCCCAAATTGATTAAAGAGTGTTTT CCCAAATTTAAAATTATAACAAAACCATTTTCCTGTTGAAATGGTTTCTA TGTGTTGTACTCCAAAACCATTAGATGTACTTAATGGTTTTGGAGTAGAA ATAGGAGGATCTATAAAGCTATAGTTCAGTCGAATTTAGTAGAAAATTTG TTAGGTATTTCTTAGTTTCCTGTTAAAATGGATATTTATAGTAGTAACAT ATTGAACATTTTCATAGTAGTTTAATTATGAAAAAGATGTAATCAAAAAA CGACACCTAAGGCTGCTAGAACTTAGAAGTTACTTTAATAAGATTACTTC GCCAGGCAGAATTTGGCTCGCCATGGCGAGATACTTTTGTCCTGATTTTC CAACTTTCTGGACCTCTTCGCCTTTCAGCTCGCCAGTGTTTCGCCAGGCC GAATTTCTTGCCATGGCCAACTCTGTGGCGAAGTGGCCTGGAGCTCTTTG GAGGTCTTCGCCTTCCAGCTCGCCTTTGGATCGCCATGGCGAGCTTGCCT TGGTCAAATTGGTCATCTCTCTAAGCTCACTTATCTTGATTTGTCTAACA ATTTTCTTGATGGCCAGGTACCTCCTTCAATAGATAATCTTAGGCAATTA AACTACCTAGATATCTCTTTGAACTCTTTTCAAGGTTCCATCCCTCCCGA ATTGTGGTTGCTAAAAAATCTCACTTTCTTAGATCTATCTAACAATAGAT TCAAAGGTGAGATACCTTCTTCACTAGGAAATCTCAAACAATTATATGAG CTAAACATCTCTCACAACAACATTCAAGGTTCCATTCCACTTGAGTTGGG AATCCTGGAAAGTATAACTACATTAGATCTTTCTAACAATAGACTCACTG GAAACTTGCCAATTTCTCTTACAAATCTCACACAATTAGAATACCTTGAC ATCTCATACAATTTTCTCACTGGTTTCCTTCCATATAACTTTGATCAATT AACTGAATTGCAAGTGTTGATGTTAAATAACAACTCCATCAGTGGGACCT TTCCAATCTCGTTAACAAATCTCTCTCAATTAGAAACCCTTGATATTTCC CACAATTTAATCCATGGTGTCCTTCCTTCCAAAATATTTCCATTTATTGA TTACGTAACTTCCATTGACCTCAGTCACAACCTCATTGGTGGTGAAATCC CTTATGAGCTTGGATATTTTCAAAGTCTTATTTTAAGCAATAATAATCTC ACTGGAACAATTCCAAAATCTATTTGCAATGTTAATTTTATGAACATTTC CCACAACTATTTAAGTGGTCCCATTCCAAATTTTGTTGATCCTTATAGAG TAATAGGGAACAAGGATTTATGTATCAACATTCCATACAAGAAAATGCAC TTCCAATTCCAAACTTGTGCATCTCCCAAGAAAAGTAATAAAGTAAAGCA CCATGTTTTCATTGCTCTTCCTATCCTTATTATTCTAATCTTAGCCTTAT CACTTATCATATGCTTCAAATTTCGTCATACATCTGTTAAGAACAAGCAT GCAAACACAACAACAACAAAGAATGGGGATTTGTTTTGTGTATGGAACTA TGACGGAAAAATAGCATTTGATGACATTATTAAAGCAACAGAGGACTTTG ACATGAGATATTGCATTGGAACAGGAGCATATGGAAGTGTTTACAAGGCA CAATTACCAAGTGGCAAGGTTGTTGCCTTAAAGAAACTTCATGGTTATGA AGCCGAGGTTCAATCTTTTGATTAGAGTTTCGAAATGAAGTGAGAATATT ATCAGAAATAAAGCACCGACATATTGTGAAGCTTTATGGATTCTGCTTGC ACAAAAGAATCATGTTTTTGATCTATCAATACATGGAGAGAGGAAGCTTA TTCTCTGTCTTGTATGATGATGTAGAAGCCGTAGAATTCAAGTGGAGAAA AAGGGTTAATACTGTTAAAGGAGTTGCATTTGCACTTTCATATCTTCATC ATGATTGCACTGCTCCAATAGTGCATAGAGAGTTATCTACTAGCAATATC TTGCTAAACTCTGAGTGGCAGGCCAGTGTTTGTGACTTTGGCACAGCTCG ACTCCTTCAATATGATTCATCCAATCGAACTATAGTCGCTGGAACTATTG GATATATTGCTCCTGGTAAATTGATCAGTGATTTTTTTTTCTTTTCATGT TCTGTTGTTTTCTTCATTTTTGTATGATGCACATCATGCATATTCATAAT CCATATAAATAACATACATGTTCATTAGTTTTTCATGCTAAGTAGTAATT TTCAATTATTTTCATTGGATTCTTTTGAATACTCATACTAATTTGATCAA TGCAGAACTTGCATATACTATGGCTGTGAATGAAAAGTGTGATGTATACA GTTTTGGTGTAGTGGCACTTGAAACTTTAATTGGAAGGCACCCTGGGGAT ATATTGTCATCATTTCAATCAACATCGACACAAAGTATCAAATTATGTCA AGTATTAGATCAACGTCTTCCACTTCCAAATAATGAAATAGTTATACGTG ACATAATTCATGTTGCCATGGTAGCATTTGCATGCTTAAATCTCAATCCT CGTTCTCGACCAACAATGAAATGTGTGTCACAAAGTTTTGCCACAGAGCT TACACCATTAAGCATTCCTTTGAGTGAAATTTCAGTGCAGCAACTAATGA GTGAAGAACTCAAAGCATTATTTTATATTGGGAACCCTTGAAAGAAAAAC TTGAGTGTGTTATTATTCAATAATAAAGACATTGTCTTTTTTTTTTCTTT CCCAAAAGTTGTTGAAAAATGCTGTAAAATTTTGTTGTTCTGATATATCA AACATATGTATATATGTATTCACATTTCTGTTTTTGAATAAAATTGAACT AGTTTTGTTTCAATTATTATGTAAATTGAACTAAAAGATAGAGGTATTGC ATTTACTTAAATAACTGAATGAATATTTTATTTTTTATACTCCATTTATC AATGTATGTCCTATGATATTATTATTTTTCTCTTCAGAAAAGACACTCTT GATATTTGAGTAAACCAAACAACTATTCTCGTCCCTGAATTTGAATTATG CACTGAAGCATAACATAGTAAACTTAGCTTAAGCATTGCCTTACTAGTTA TATAGGTAATTGGTTTGTGAGAAAAGTAAGCAACTCACTTTGAGATGAGT TGAGAAACCACTTTAAAGTGTTCATACAATGTCACAACACAGTGTCACAT TGCTATTCATGACCAATTCTTATCTACATATTTTTCCTTTCAATTATAAG AAAATAAGTAATACTTAAACAACTCACATGTATGAGTGTGTCTCCTTCTT TTTGTTCATTTCGGATGTGAGTGAATATAATTTATTTTTTTTAATAATAA AAAACCTTATGTTTGAAGCAACCATCTCTGTCTCATAAAGTGGTTACCAA CTTACCATCCTTGTAATGTAGGAAGAAAAAATGGTTCGAATCCTGAATTT TGGCACATTACCTTGCCAGAAAAATTTCAAGTGGAATGGAGTTGATGTAC AGTTTCAAGTGCAGGTGGATGAATCATTTTATTCGCACTTGAGTGCAATG AGAGCCAAAACTGTAGCTGAACGGAAATGTTTTTTGTCCTGTTCTTTTAG CCACTATGGCTGCTGATGGTGCCAATATTCCGGTGATTATCATAGATTCA TATACTTTATTGAGATTCGTCTACTTTATTCCGGTAAGTAGCCATATTTG ACTCGGTTATTGTGTGAATCAAACAAGGTTCAAGAGTTATGTGCACAGAT ATTCATCTTTCATGTGTGATGAACATTTTTCAAACTGGTTTTAATCAATT TTTATATGTTTCTACATTCCATGAGATTCTAAATTTTTAATCCTACGTTC TGTTTCATTGATATGAAAAGGTAATGCTGATAATGTTGGGGAGATCAAGT TGAACGATATGTGGTCTTCTGTAGATCATCAAAAAGATAATGATAAATCC TTCGTTGAATTGATTGAAAATGTTGAAGCATTGTTGTCGCAAGTTGAGAA TTTGAAAACTCGGATTGATACCGTGAAATATGAAAATCCTGGAAAGTTCT GTTCTGCAACTCAATCAAACATAGTTGGGCCATCTAATGGATTTAATCGT TCTGTTCATAATTCTGCTTCTTTTGCCGGTAAAGAAATTCTGGTTCAATA AAGAATGGGGATTTATTTTGTACATTATTATTCTAATCTTAGGCTTATCA TTTCTCATATGCTTCAAACTTCATCATAGTTCTGTTAAAAACAAAGAATG GGGATTTATTTTGTGTATGGAATTATAACGGAAAAATAACATTTGATGAC ATTATTAAATCTGAATGAAAGGGAGTATTTTGATAATAATTCAGAGTTTG GTGTTATTAATTTAGATTGGTTTAATTAATTAGTTAAGTGCTTGTTAGCT GATCCAATTGTGGTTATGGATAGTGCTTCATTAGTTGATAACTAACCTAT TAGTTAGTTAGTTAGTTATAAGATAACTTGCGTTGCAAGTTATCTTACTA ACCTATAAATACATTGAACTACTAAATTCAATTTACATTTCACTCATCTC ATTCTCTTTCTTTGAATTTTGGTCATTGGTGAACCATCTTTATTTCAGAA AAGCCGCGACAAAGATGGGTTGCGAAGAGACTAATCCACAAAATGCAAAT TTTCGTCTATCACAAATTTGATGTTATAGACTCAATTTTCAAAGTGAACA TCTGATTATTAGAAATTGGATAAGAGAAATAATAAATAGTAAGAAAGAGA GCAATATAAAAGTGATACAAAGTCGGAGTGACTTTCCTACTTTCCTATTT AAAACAACGAAAAATAAATATATAGTTTGTATTAAACTGACATCAATTAA ATCACGTACTTAATCGTAAAAAATATTGATCCATACTGAACCAATTATGT CTAATGACTCCCTTTACTTGGTTAGTTTCCTGCTTTTTGGAACAAAAAGC ACATTAAAGTTGACTTATTGACTAAGAAACTAATATACAAAACTTTATAA TTGACCAAGTCAATAGGCGACATGGGAAACACATGCATGTGTATAGACGT AACGCGTGGGGAATTAGAAACCTATACATAGAAATAACGGGTCCCTCTAA AAAAAGAAAAGTAATATGTGGGTCAACATTTAAGAGATAGTTACATAAAA ATAGATAGTAAAGTTTACTATACATTTTTTTAACATTAATTCTATTTGTC GGTGAAACTCATAATTCTCATCATTTATGTGTAATATTTTTAAAATTTGG GAAACAAACTAGTTTTACTAAATAAAAAAATAAAATTAAAACGAGTATTT AAAAGAGAGTGTACATTACACTTATACAAAAATAAATATGAATGATTATG ACAATGAAATTGTATATGTAAAATGCATTGAACTCAAAAATTAAAATAAA TTTCAGGTAAGGTTGAAACTTCATATTAGCCCACAATCCTTTTCAGCGAT GAACAAAGTTAACTATGAGAATTTTCATACTCATAATAAAATGAAATTTT TGGCAAATTTTGTTTTACTAAAATGAATTTTGATCGTAGGGTTAGAAATA GGAAGTCCTTGCAACAACGTCATATCCTAGGTTGCTTGGCTAAGTGGAGA GAAATTGATGGTTTTGTTGAGTTGGTTGACGGTGTGTTGAGCGAACCAGG ACAAGTTGGTAGAGGTAATGGAGGAGAGGATTTTGAGGAAAAAGACAAAA AGAGGGTCCTAACATCTATAATTATTGTACATATTCTTTTGATATGGCTT CTTTTAAATTTTGAACTGAATTAATTATTTTTTCACAAAAACATCTATAA TTATTGTACATATTCTTCCCTCAAAAAAAAAAAAAAAATTATTGTACATA TTCTTTTGTACTCTTTTTGTCTCTGAATATATCTAACAAATGGAGTACTA TAACTAACTATAAATACTTTGAGATAAATCAATTCATCCTCCTAATTGAT AAATTTATACAATATACAAATTGTTAACAAATTCAATAATATAATTATTA TTTTTATTTTTCGGGATTTAGATAAAGAGATTTTATATTTAGGATCGAAA ATGATACTTGAGAAGAATTATTGCAGAGGTTAATTTGACATAAAATTGTT GAACGTAAATGGAGGAGTAGATGCTTGCTTTAATTGGGCCCTCAAATATA ACCAATAATTATATGTTCACACGTACTAGACTTATCTTATAAATGAATCA AATTAGTGTGTGACAATGAGAATGACCGACGAAGTCACACAACATAAAGG TTTTTATGGTCATTCATTTGATCTCAAAAACAAAAACAAAAAAATAGTTT CAGTTTCTTTGGTCCAAAAATGTGGATTGCCTTTCTTCTTATTTGCAGTT TGATTGTGGGAACTCAATGTGCTGCCACTGAGACATCTCATCAACTTCAA ATGGAAGCAAATGCTATAATAAATAGTGGATGGTGGTACACATCTGATCC ACTCTTCAATATCTCTGGTCGTTGTAATTGGCCGTATGATATTATATCTT GCAACGATGATGGAAGCATAAAAGCAATCAACATATGGGGGAATGAACTT GTAACGAACAACTTGTCTACTTTCAACTTTTCTGCTTTTAACAATTTAGA AAGCCTTGTTATAAGCTCAGTTGAACTATATGGGAGTATCCCAAAAGAAA TTGGTCATCTCTCTAAGCTCACTCTTCTTGATTTGTCTAGCAACTTTCTT GAAGGCCAGGTACCTCCTTCAATAGATAATCTTAGACAAGTAAAGTACTT AGACATCTCTTTTAACAATATTAATGGTTCCATCCCTCCCGAATTGTGGT TGCTAAAAAATCTCACTTTCTTAGATCTATCTAACAATAGATTCCAAGGT GAGATGCCTTCTTCATTGGGAAATCTCAAACAATTAGAGAAGTTGAACAT CTCTAACAATTACATTCAAGGTTCCATTCCTGTTGAGTTGGGGTTCTTGA AAAATCTCACAAGATTAGATCTATCTTACAATAGATTCAATAAAAACTTG CCTATATCCCTTACAAACCTCACAAAGTTACAATACCTTAACATCTCTAA CAATTTTATCAATGGTTTGCTCCCATTTAACTTTGATCAATTAATCAATT TGCAAGTGTTGATTCTAAATAACAATTTAATCAGTGGAACATTTCCAATT TCCTTAACAAATCTCTCTCTATTAGAAACCCTTGACATTTCCCATAACTA CTTTGAAGGTTATATTCCTTTTGAGTTGGGGTTCCTCAAAAATCTCACTT TCTTATATCTATCTAACAATAGATTCAAAGGTGAGATACCTTCTTCCCTA GGAAATCTAAGACAATTACTGGAGCTAGACATCTCTCACAACAACCTTAA TGGTTCCATTCCTCATGAGTTGGGGTTCCTCAAAAATCTCACTTTCTTAT TTCTATCTAACAATAGATTCAAAGGTGAGATACCTTCTTCACTAGGAAAT CTAATACAATTACAGGAGCTAGACATCTCTCACAACAACCTTAATGGTTC CATTCCTCATGAGTTGGGGTTCTTGAAATATGTCTCTTCATTAGATCTAT CTCACAATAGATTCAAAGGTGAGATACCTTCTTCACTAGGAAATCTAATA CAATTACAGGAGCTAAACATCTCTCACAACAACCTTAAAGGTTCCATTCC TATTTTTCTTTTACAATTAGAATACCTTGACATCAGTCACAACCTCATTA GTGGTGAAATACCTTCTGACCTTGGATATTTTTACCAACTTAATTTAAGC AATAATAATCTCACTGGAACAATTCCCCAATCTCTCTGTAATTTCTATGA TTATGTGGACATTTCATACAATTGTTTGGAGGGTCCCATTCCAATTTGTC TTGATATGGAAAATTCTGATGTATGTTCATTTAACCAATTCCAACCTTGG TCACCACACAAGAAAAATAATAAATTAAAACACATTGCTGTCATTGTTCT TCCGATTCTTATTATTCTAGTCCTAGTCTTCATCATATTCTTAAATCTTC ATCATAATTCAAAGAAGAAGTTGCATGGGAACTTAACAAAAACAAAGAAT GGAGATATGTTTTGTATATGGAATTATGATGGGAAGATAGCATATGATGA CATAATCAAAGCAACAGAAGACTTTGACATGAGATATTGCATTGGAACAG GAGCATATGGAAGTGTTTACAAGGCACAATTACCATGTGGAAAGGTTGTT GCCTTAAAGAAACTTCACGGCTATGAAGCAGAGGTTCCATATTTTGATGA GAGTTTCAGAAACGAAGTGAAGATATTATCAGAAATAAAGCACAAACATA TTGTGAAGCTTTATGGATTCTGCTTGCACAAAAGAATCATGTTTTTGATC TATCAATACATGGAGAAAGGAAGCTTGTTCTCTGTCTTGTATGATGATGT GGAAGCGGTGGAATTCAAGTGGAGAAAAAGGGTTAACACTATTAAAGGAG TGGCATTTGCTCTATCTTATCTTCATCATGATTGCACTGCTCCAATCGTG CATAGAGAT
back to top
Properties
Property NameValue
NoteLRR receptor-like kinase family protein MAKER:7.9:0.11:Medtr7g007560
CADL Non-redundant FlagY
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
Whole Genome Assembly and Annotation of Medicago sativa2016-01-05
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Scc4a34_3supercontigScc4a34_3:3953..12711 -